Predation by squirrel monkeys and double-toothed kites on tent-making bats

Central American squirrel monkeys (Saimiri oerstedi) appear to recognize the modified leaves that phyllostomid bats utilize for diurnal roost sites. The monkeys visually and manually search these bat tents for both bats and insects. Adult males are the most successful at capturing bats. Nonvolant juvenile bats are more vulnerable to monkey predation than are adults. Bats that escape monkey predation frequently are captured by doubletoothed kites (Harpagus bidentatus) that tend foraging troops of monkeys. Predation by squirrel monkeys, coupled with that of double-toothed kites, may be a significant source of mortality for tent-making bats.     

Chromosome evolution in the owl monkey,Aotus

We have reported nine distinct karyotypes for Aotus, of four pelagic phenotypes, and suggest that this single species has undergone extensive subspeciation. We reconstruct the mechanism of chromosomal evolution and propose a hypothesis about the events of subspeciation in Aotus. We speculate that isolated groups of ancestral individuals living in several confined areas have separately accumulated a fusion or inversion pair as a result of inbreeding. A subsequent reassociation of descendants from these individuals led to the formation of offspring with mixtures of fusion or inversion pairs in their complements. They, in turn, radiated into different ecological niches accompanied by adaptive genetic changes and eventually gave rise to the present forms of Aotus distinguishable by their karyotypes, but not easily recognizable by ordinary taxonomic criteria.     

Osteoblasts and collagen orientation

Summary Bone was removed from the calvaria of anaesthetized 70 g rats or freshly killed young monkeys and the fibrous periosteum dissected off the inner, formative surface under 0.15 M cacodylate buffer. The bone and undisturbed osteoblasts were fixed in 3% glutaraldehyde in the same buffer for 24 to 48 hours, critical point dried and coated with evaporated carbon and gold for scanning electron microscopy (SEM). Fields of osteoblasts were photographed and chosen cells dissected off the osteoid using a tungsten needle. The control of the dissection was made possible by the use of a system of real-time stereo TV-speed SEM. The fields were rephotographed and the orientations of the osteoblasts were compared with that of the underlying collagen fibres. 62% of all osteoblasts lay with their long axes within 15° of the collagen fibre orientation below and 80% within 30°. Montages of large areas of osteoblasts were also made, and then compared with ones of the same area after the cells had been stripped off on adhesive tape. In general, the orientation of the collagen tended to be the same as the cell that formed it. Collagen fibres below cells at the periphery of a domain sometimes had the orientation of the cells in the adjacent patch. It is not possible to determine whether the cells controlled the orientation of the collagen, or vice versa, from this experiment, but other SEM evidence suggests that the collagen orientation in hard tissue matrices depends on the freedom of cells to move with respect to the matrix surface. Acknowledgements. This work has been supported by generous grants from the Medical Research Council and the Science Research Council. We are grateful to Elaine Bailey and Mr. P. Reynolds for technical assistance.     

Intraductal mammary carcinoma and benign ovarian teratoma in a rhesus monkey

A benign ovarian teratoma and an intraductal mammary carcinoma were found in an adult rhesus monkey that had been used in reproductive studies and received human luteinizing hormone, follicle-stimulating hormone, and human chorionic gonadotropin.     

Leukemic histiocytic sarcoma in a captive common squirrel monkey (Saimiri sciureus) with Saimiriine Gammaherpesvirus 2 (Rhadinovirus), Saimiri sciureus lymphocryptovirus 2 (Lymphocryptovirus) and Squirrel monkey retrovirus (β-Retrovirus) coinfection

Hematopoietic neoplasia other than lymphoma and leukemia is uncommon among non-human primates. Herein, we provide the first evidence of occurrence of leukemic histiocytic sarcoma in a captive common squirrel monkey with Saimiriine Gammaherpesvirus 2 (Rhadinovirus), Saimiri sciureus lymphocryptovirus 2 (Lymphocryptovirus), and Squirrel monkey retrovirus (β-Retrovirus) coinfection.     

Co-limitation of potato growth by Potato Cyst Nematode (Globodera rostochiensis) and Rhizoctonia solani

Globodera rostochiensis and Rhizoctonia solani are the most important growth limiting factors influencing potato production in Iran. The effects of inoculation with Potato Cyst Nematodes (PCN) (0, 50, 75 and 100 cysts/3.5?kg soil) and R. solani (with or without inoculation) on potato growth and development were investigated in cultivars Santé and Marfona. Inoculation with R. solani induced severe damage, especially when inoculation was accompanied with high density of PCN. The damage caused by R. solani tended to increase with an increase in PCN density, especially in Marfona. In Santé, number of stems or branches per plant significantly increased by inoculation with R. solani, while in Marfona it was significantly affected either by R. solani inoculation or PCN density. In Santé, number of stolons per plant was significantly increased by PCN, but not by R. solani. In Marfona, however, the number of stolons per plant was significantly affected either by R. solani inoculation or by presence of PCN, but not affected by PCN density. The general effect of R. solani or PCN inoculation treatments on shoot, below-ground and total dry weight of potato was significant, but strongly affected by cultivar. In general, our study supports the synergistic interaction between R. solani and PCN and its moderation by the use of a resistant cultivar such as Santé.     

Detachment,displacement and reattachment activity in a freshwater byssate mussel (Limnoperna fortunei): the effects of light,temperature and substratum orientation

The ability of the freshwater bivalve Limnoperna fortunei to voluntarily detach from the substratum, crawl and reattach as a function of illumination, temperature, substratum orientation, and mussel size was investigated. Thirty-two per cent of the 879 experimental animals detached and reattached elsewhere at least once during five- to eight-day experiments. The proportions of mobile mussels were significantly higher in permanent darkness than under permanent illumination. Displacement distances were also higher in darkness, but statistical differences with illuminated individuals were inconclusive. No evidence of circadian rhythms was detected. Mobile mussels were often significantly smaller than non-mobile individuals. It was not possible to detect the effect of water temperature (22°C and 31°C), or substratum orientation (topside and underside) on mussel mobility, but because the power of the statistical tests was low, future experiments are needed to confirm this result. The ability of mussels to voluntarily detach and reattach elsewhere has important implications for biofouling control.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.